rs6987704 chr8:42692480 T>C
- Sequence
tcggctacagctcttctgggtttg[T/C]gctgccctcctggcaagcggtacg
- ASB in cell types
- T47D (invasive ductal carcinoma) A549 (lung carcinoma) tibial artery
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.32 | 0.40 | 1.07 | |||
| A549 (lung carcinoma) | 0.10 | 0.89 | 2.00 | |||
| tibial artery | 1.83 | -1.54 | 1.00 |
Items per page:
1 – 3 of 3