rs698792 chr2:44456080 T>G
- Sequence
ctgtatgctaccagtcttgtaacc[T/G]aaatggtgccttgtgtaattcaaa
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.18 | 1.37 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, height, irritible bowel syndrome, lp-pla2 activity, total cholesterol
GTEx eQTL Adrenal_Gland, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Pituitary, Thyroid