rs6992174 chr8:52215491 C>T
- Sequence
caacactacagacaaaattaacga[C/T]agctctcgtaagctaaaactatta
- ASB in cell types
- CRC107 (colorectal cancer metastatic stem cells)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 2.15 | -0.48 | 2.00 | -2.21 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy)