rs6993862 chr8:141169272 G>A
- Sequence
accgtggtctttacagttgccctg[G/A]gcacttacctgggaacgggtgtgg
- ASB in cell types
- neutrophils from periferal blood T47D (invasive ductal carcinoma) A549 (lung carcinoma) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 3.38 | n/a | 1.50 | |||
| T47D (invasive ductal carcinoma) | 0.44 | 1.06 | 1.09 | |||
| A549 (lung carcinoma) | 1.02 | 0.74 | 1.06 | |||
| glioblastoma cells | 1.79 | -2.86 | 1.50 | |||
| WA09 (embryonic stem cells) | 1.91 | 0.56 | 1.44 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid