rs6994706 chr8:72987222 C>T
- Sequence
tgtctatgtctggtccatagggag[C/T]gctcacacctcctttgcacaacaa
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) DND41 (acute lymphoblastic leukemia)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.61 | 0.52 | 1.47 | -2.49 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
