rs6995180 chr8:142865013 G>C
- Sequence
gcacctcggtcagcaggttttata[G/C]tgagttgtgcagtttgacctgcag
- ASB in cell types
- erythroid cells A549 (lung carcinoma) MCF7L-P(immortalized breast epithelial cell line) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | -4.09 | 2.43 | 1.50 | |||
| A549 (lung carcinoma) | 0.97 | 0.61 | 1.05 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 1.48 | 0.14 | 1.50 | |||
| Kelly (neuroblastoma) | 1.42 | 0.63 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid