rs6995524 - ADASTRA v6.1.1

Sequence: ttccacaaattatgaattggcaag[C/G]aatgcccccctgtggactgtcaca
ASB in cell types: MCF7 (Invasive ductal breast carcinoma) MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) THP-1 (acute monocytic leukemia) GM02255 (Lymphoblastoid Cell Lines)
ASB for transcription factors: CTCF_HUMAN FOXA1_HUMAN RAD21_HUMAN ANDR_HUMAN
: Search SNPs nearby
View in UCSC Genome Browser
View in PheLiGe
0.05
FDR threshold
0
ES threshold

Transcription factors

Cell types

Uniprot ID	Effect size Ref	Effect size Alt	FDR Ref	FDR Alt	Mean BAD	Motif fold change	Motif concordance
CTCF_HUMAN	2.08	-0.13	5.9·10^-38	1.00	1.49	-0.27	Weak Concordant
FOXA1_HUMAN	1.56	0.22	7.1·10^-15	1.00	2.13	n/a	No Hit
RAD21_HUMAN	2.10	-0.21	3.1·10^-7	1.00	1.72	n/a	n/a
ANDR_HUMAN	2.73	n/a	0.02	1.00	2.00	n/a	No Hit
STAG1_HUMAN	1.90	0.01	0.02	0.96	2.00	n/a	n/a

Items per page:

1 – 5 of 7

CTCF_HUMAN

Weak Concordant

GRASP college completion, infant head circumference, total cholesterol, triglycerides, years of education

GTEx eQTL Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic