rs6996098 chr8:115922753 G>C
- Sequence
ggaactgagacctattgccaacat[G/C]cacatgagtgaggctggacacaag
- ASB in cell types
- monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages from peripheral blood | n/a | 2.52 | 2.50 |
Items per page:
1 – 1 of 1