rs6998745 chr8:60280648 C>T
- Sequence
agaaacactttctccccaaagtct[C/T]caagccaaaaacgaattcttcacg
- ASB in cell types
- K562 (myelogenous leukemia) neural progenitors
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 0.92 | 1.78 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, cognitive response to topiramate treatment as measured by the animals cognitive test, hip bone mineral density (bmd), longstanding arthritis, spine bone mineral density (bmd), stabilized warfarin dose
GTEx eQTL Adipose_Subcutaneous, Brain_Cortex, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood