rs6999554 chr8:17699580 T>C
- Sequence
aaagaagaaattaccatctaatca[T/C]cgattaatcagattcattaacatt
- ASB in cell types
- A549 (lung carcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.05 | -0.16 | 2.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 0.56 | -0.58 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Whole_Blood