rs6999814 chr8:41803336 C>A
- Sequence
tgttgagctctattatgaggtctc[C/A]tagtttgtccctggctggtctgag
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -0.85 | 2.19 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, homa-b, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), mean corpuscular hemoglobin concentration (mchc), schizophrenia
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Nerve_Tibial