rs7000858 chr8:121377052 T>G
- Sequence
tgcaaccaactcacatgcccagat[T/G]ggagtttcattccacttggtctgc
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -3.35 | 2.52 | 2.50 | |||
| MDM(monocyte derived macrophages) | 1.53 | 1.83 | 2.33 |
Items per page:
1 – 2 of 2