rs700162 chr5:35963405 T>G
- Sequence
caaaaacggatttcaggggctgca[T/G]gtatcttgtttagattgtctcaaa
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -1.05 | 1.37 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 1.31 | -0.56 | 1.83 |
Items per page:
1 – 2 of 2