rs7003387 chr8:94949751 C>G
- Sequence
ggtggatctctccctcagcgaccc[C/G]tctcgccgagtgaagggtcgaggg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) MCF10A (breast epithelial cells) LNCaP C4-2B (prostate carcinoma)
- ASB for transcription factors
- ZFX_HUMAN GATA3_HUMAN MNT_HUMAN NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 0.28 | 1.33 | 1.44 | n/a | No Hit | |||
| GATA3_HUMAN | -1.90 | 2.29 | 1.00 | n/a | No Hit | |||
| MNT_HUMAN | -0.13 | 1.75 | 2.00 | n/a | No Hit | |||
| NRF1_HUMAN | -1.52 | 1.71 | 1.50 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Whole_Blood