rs7003747 chr8:61244183 C>T
- Sequence
ggggcagtgcagtatagggcattg[C/T]attttttttttaatcctttagttc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) foreskin keratinocyte GM18951 (B-cells Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.99 | -0.18 | 1.03 | n/a | n/a | |||
| CTCF_HUMAN | 0.83 | 0.68 | 1.32 | 0.32 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
