rs7003775 chr8:42206842 T>A
- Sequence
tgtcctttaaggaggactgcacac[T/A]tgactgatgcaccctgggcaaaaa
- ASB in cell types
- HEK293 (embryonic kidney) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.03 | 0.75 | 1.79 | |||
| breast tumor | 2.17 | -1.10 | 2.00 |
Items per page:
1 – 2 of 2