rs7003897 chr8:21484413 G>A
- Sequence
aatgttattttctggtgcacccag[G/A]tttcattagtcttcctgtcaggga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN IKZF2_HUMAN ENL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.59 | -0.85 | 1.00 | n/a | n/a | |||
| IKZF2_HUMAN | 1.44 | -0.94 | 1.00 | n/a | n/a | |||
| ENL_HUMAN | 2.35 | -1.83 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence, maternal transmission distortion, neuroblastoma (brain cancer), transmission distortion