rs7004211 chr8:129581810 T>C
- Sequence
tctaccccaatgggcagccctaaa[T/C]acagctgtctgatgtcccaggcag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.88 | -0.92 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, cystatin c in serum, obesity with early age of onset (age >2), waist hip ratio, years of education