rs7004276 chr8:144327017 G>A
- Sequence
tcgccgcggccgcaccggcgcaga[G/A]caccctgggagccgtggcagctcc
- ASB in cell types
- WA09 (embryonic stem cells) breast tumor HepG2 (hepatoblastoma) primary breast cancer
- ASB for transcription factors
- ZN143_HUMAN ESR1_HUMAN TP53B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | 1.96 | n/a | 1.50 | -2.85 | Concordant | |||
| ESR1_HUMAN | 2.56 | -0.16 | 1.67 | n/a | No Hit | |||
| TP53B_HUMAN | 2.81 | 1.17 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood