rs7004619 chr8:143058863 G>A
- Sequence
gtggccctgtccgggcataacaga[G/A]ggctcgcactcttgtcttccggtc
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) Peyer's patch upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.31 | -1.97 | 1.00 | |||
| Peyer's patch | 2.07 | -1.49 | 1.00 | |||
| upper lobe of left lung | 1.64 | -0.54 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cortex, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood