rs7007162 chr8:61054738 G>C
- Sequence
cgtgcagataaacaggttattcag[G/C]cttcctcatctctctcctatacct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.08 | 0.16 | 2.64 | |||
| K562 (myelogenous leukemia) | -0.02 | 0.70 | 2.01 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, fasting blood glucose, homa-ir, serum creatinine, total cholesterol, triglycerides