rs7008646 chr8:13469408 C>A
- Sequence
gctctgactccctgagctctgagt[C/A]atagctgtaactgaattgctctgt
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.44 | n/a | 1.33 | -4.67 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, bipolar disorder, height, obesity with early age of onset (age >2), serum creatinine, tetrology of fallot