rs7009064 chr8:131111296 T>C
- Sequence
tgatcctcttttctgtttcctctt[T/C]gcttggcagactgccatccaggcc
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.53 | 1.44 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, infant head circumference, ldl cholesterol change with statins, neuroblastoma (brain cancer), total cholesterol change with statins, urinary albumin-to-creatinine ratio