rs7009732 chr8:25430509 G>C
- Sequence
gggtactcctcatgagaatctaat[G/C]cctgatgatctgtcactgtctcca
- ASB for transcription factors
- GLIS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | n/a | 3.73 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg