rs701024 chr12:124551793 G>A
- Sequence
gcctgggggaaggaggcgcgggcc[G/A]ttttcttcctctttttaataagct
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.77 | -1.59 | 2.00 | 2.08 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, ldl cholesterol change with statins, maternal transmission distortion, rheumatoid arthritis, total cholesterol change with statins, transmission distortion, triglycerides