rs7010283 chr8:133445511 C>G
- Sequence
attgctggatcatatgctggttct[C/G]tttttgattttttgaggaactgcc
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.74 | 0.54 | 1.33 |
Items per page:
1 – 1 of 1