rs701044 chr12:124608628 G>A
- Sequence
tttcaatctcacttcttccccagg[G/A]ccccaggtggcatctgtctttggc
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-BR-3 (breast adenocarcinoma) | -0.29 | 1.49 | 1.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.16 | 0.05 | 1.10 |
Items per page:
1 – 2 of 2