rs7010602 chr8:143567380 A>G
- Sequence
gggcccgcgggggcagccccgggc[A/G]cgggccagcatcgccacctgctga
- ASB in cell types
- GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | -1.88 | 2.28 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood