rs7011299 chr8:90001011 C>G
- Sequence
cttagtgtttttcagcctcttggt[C/G]ttagggaaagtgaggccgtgtttt
- ASB in cell types
- neutrophils from periferal blood THP-1 (acute monocytic leukemia) HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -3.18 | 3.02 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.19 | 1.15 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.40 | 1.06 | 1.20 | |||
| A549 (lung carcinoma) | 0.77 | 0.28 | 1.95 | |||
| erythroid cells | -4.63 | 2.11 | 2.00 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Spleen, Testis, Thyroid, Whole_Blood