rs7011341 chr8:123167695 T>C
- Sequence
cgtttgtgcctgaaattgcacaat[T/C]ggattgtggcagttgcatcatctg
- ASB in cell types
- MSC (mesenchymal stem cells) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MSC (mesenchymal stem cells) | 2.88 | -4.79 | 1.50 | |||
| THP-1 (acute monocytic leukemia) | 0.35 | 1.25 | 2.00 |
Items per page:
1 – 2 of 2