rs7012321 chr8:104326163 C>T
- Sequence
taaagagcttcagagaatgaaatt[C/T]ccagccctccgcagacatgggaag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM17942 (lymphoblastoid cell) GM18526 (B – cells Lymphoblastoid Cell Lines) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.37 | 0.25 | 1.48 | |||
| GM17942 (lymphoblastoid cell) | -2.07 | 2.07 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.69 | 1.10 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 1.32 | -0.16 | 1.50 | |||
| MS-1 (Small cell lung carcinoma) | 0.88 | -0.19 | 1.00 |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cortex, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Thyroid