rs7012343 chr8:123448008 G>C
- Sequence
ttacatgactgacctgtgaaactc[G/C]tgcccactccttcacacctttgcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) adult erythroblasts CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | 2.98 | -2.64 | 1.00 | -3.68 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, aortic valve calcium, homa-b, obesity with early age of onset (age >2), total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg