rs701608 chr1:208450130 T>G
- Sequence
tctgagtttctgaactcttgcgcc[T/G]cctgtcggcagccaacaggttcta
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.27 | 1.29 | 1.22 | 0.26 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, alzheimers disease, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, paternal transmission distortion, salmonella-induced pyroptosis, transmission distortion, waist hip ratio