rs7016388 chr8:120089626 A>G
- Sequence
aagctgcatttcaagtgcctgata[A/G]ttttttccacttgtggctactggc
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.65 | n/a | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -1.63 | 2.03 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism with low iq, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hiv-1 control (viral load at set point), serum creatinine, triglycerides change with statins, years of education
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid