rs7016839 chr8:9730439 C>T
- Sequence
agtggcccaggcagaaaaataatt[C/T]tccagaccctttttgcttgcttga
- ASB in cell types
- embryonic stem cells derived definitive endoderm
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic stem cells derived definitive endoderm | 1.88 | -0.24 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Testis, Thyroid