rs7018914 chr9:114487828 T>C
- Sequence
aggacctgaattcccctgacaatg[T/C]ggacagggctgggtggaggcctcg
- ASB in cell types
- CD34+ stem cells-derived erythroblasts MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.27 | -1.33 | 2.00 | |||
| MM1.S (plasma cell myeloma) | 1.19 | -0.26 | 1.20 |
Items per page:
1 – 2 of 2