rs7019283 chr9:35945978 G>C
- Sequence
cctgccaaagtagaaatgggtttt[G/C]agtttcagccatgtcacaaattga
- ASB in cell types
- foreskin keratinocyte epidermal keratinocytes erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.64 | n/a | 2.33 | |||
| epidermal keratinocytes | 2.60 | -1.82 | 2.00 | |||
| erythroid progenitors | 2.21 | -1.47 | 2.00 |
Items per page:
1 – 3 of 3