rs7019671 chr9:137169863 C>A
- Sequence
cgagggcgaggccgtggccgacac[C/A]tgggcccagacaggccaaggcgac
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-453 (breast adenocarcinoma) | 0.32 | 1.69 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood