rs7019707 chr9:614036 G>C
- Sequence
tccaagcatctctgggtggcactg[G/C]agggccatttttcacaaggagcaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) adrenal gland upper lobe of left lung 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN TRI22_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.80 | 1.00 | 1.48 | -0.07 | Weak Discordant | |||
| TRI22_HUMAN | -0.42 | 1.74 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
