rs7021011 chr9:6908195 T>G
- Sequence
cctttacattagttgtttcttaaa[T/G]gaagtgcccattttatgtgtagga
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.90 | -1.60 | 1.00 | |||
| glioblastoma cells | 2.21 | -1.65 | 1.00 |
Items per page:
1 – 2 of 2