rs7021042 chr9:15486352 G>A
- Sequence
tctacactagaattctgaattata[G/A]gggtggataaatttgaattgtgaa
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.54 | 1.16 | 1.05 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, fasting blood glucose, fasting insulin, homa-b, homa-ir, infant head circumference, microalbuminuria, years of education
GTEx eQTL Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Testis, Thyroid