rs7021581 chr9:126385628 C>G
- Sequence
acactgggcttcggggatgaggca[C/G]ttctgcaaaatgggcacgtggagt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.57 | -1.22 | 1.00 | -1.38 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
