rs702165 chr9:1605359 T>G
- Sequence
ttaggaaagcaatgccgctagtct[T/G]ggagccacactttgagaatctctg
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.15 | -0.74 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.56 | -1.36 | 1.00 |
Items per page:
1 – 2 of 2