rs7022073 chr9:117073866 T>C
- Sequence
gacttcaccaggtgaggctgagaa[T/C]ggaacaaagcctgccctagtggat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) SK-N-SH (neuroblastoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.19 | 0.76 | 1.00 | |||
| SK-N-SH (neuroblastoma) | 1.68 | 0.15 | 1.12 | |||
| foreskin keratinocyte | 0.64 | n/a | 2.67 |
Items per page:
1 – 3 of 3