rs7022282 chr9:88594115 G>T
- Sequence
ttttcttttcagtctttctcaaaa[G/T]tttatgctttcaaaaagccctttt
- ASB in cell types
- foreskin keratinocyte neural progenitors liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.83 | n/a | 2.00 | |||
| neural progenitors | -1.76 | 2.16 | 1.00 | |||
| liver | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 3 of 3