rs7023704 chr9:81592983 C>G
- Sequence
acagctatttccttattgaatctc[C/G]agggagaaattgcccttgtgcacc
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SEM (childhood B acute lymphoblastic leukemia) | 1.24 | -1.19 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, body mass index (bmi), hdl cholesterol, triglycerides