rs7024497 chr9:126398775 C>G
- Sequence
ggccagccaggaggacctaggaag[C/G]ggtgggtcacagatcttgctgcct
- ASB in cell types
- GM23338 T cells from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | 0.17 | 2.09 | 1.25 | |||
| T cells from peripheral blood | 2.07 | -1.49 | 1.00 |
Items per page:
1 – 2 of 2