rs7027405 chr9:98806063 G>A
- Sequence
ggtccagacctacctaacacaacc[G/A]ccttctggcattaaccagcagcct
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 2.64 | -0.31 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood