rs7027520 chr9:19457587 G>A
- Sequence
ctactgggtgggagggacggagac[G/A]ctcctggagtaatactgccatctt
- ASB in cell types
- WA09 (embryonic stem cells) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 2.11 | 0.11 | 1.42 | |||
| epidermal keratinocytes | 2.02 | -0.12 | 2.00 |
Items per page:
1 – 2 of 2