rs7029776 chr9:124062551 A>G
- Sequence
aattgcaggaatcttagacacaat[A/G]cagacccactgccctctgggaaag
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.62 | 2.88 | 1.10 | n/a | No Hit | |||
| STAG1_HUMAN | 0.15 | 1.54 | 1.08 | n/a | n/a |
Items per page:
1 – 2 of 2